View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19505_low_27 (Length: 237)
Name: NF19505_low_27
Description: NF19505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19505_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 45347700 - 45347477
Alignment:
| Q |
1 |
cactgcaaaaaatagaaacaagtcaaaatgattcatgattaactaccatcaaataataatccaaaattggaaaatgaaacaata---ttgaacaatgagc |
97 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45347700 |
cactgcaaaaaatagaaacaagtcagaatgattcatgattaactaccatcaaataataattaaaaattggaaaatgaaacaataatattgaacaatgagc |
45347601 |
T |
|
| Q |
98 |
ccaccagaattcggttatttcaggtggttgttatagaaagttgacaggtaaatatttgaatcctcgggttgggagggagagattatgtgtaagttgtgag |
197 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45347600 |
ccaccagagttcggttatttcaggtggttgttatagaaagttgacagttaaatatttgaatcctcgggttgggggggagagattatgtgtaagttgtgag |
45347501 |
T |
|
| Q |
198 |
gcacacaggaaggaaggaaggaag |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45347500 |
gcacacaggaaggaaggaaggaag |
45347477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University