View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19505_low_32 (Length: 227)

Name: NF19505_low_32
Description: NF19505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19505_low_32
NF19505_low_32
[»] chr2 (1 HSPs)
chr2 (1-221)||(10760757-10760977)


Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 10760977 - 10760757
Alignment:
1 cggttttcttcgccttgctggtttctgtgatgaaataagctcaggccttgctatggagggaaatattttcttgccttcaacttgaatagagactttaaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10760977 cggttttcttcgccttgctggtttctgtgatgaaataagctcaggccttgctatggagggaaatattttcttgccttcaacttgaatagagactttaaca 10760878  T
101 taagcttgactttgggattggacttgtgttaaaatgctgataggtgttttgcatcttataatctcttgagcaactgatagaacatcagatttaaataaga 200  Q
    |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
10760877 taagcttggctttgggattggacttgtgttaatatgctgataggtgttttgcatcttattatctcttgagcaactgatagaacatcagatttaaataaga 10760778  T
201 aattgggcttcgtgaaatccc 221  Q
    |||| ||||||||||||||||    
10760777 aattcggcttcgtgaaatccc 10760757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University