View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19505_low_34 (Length: 221)
Name: NF19505_low_34
Description: NF19505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19505_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 206
Target Start/End: Original strand, 37603808 - 37604000
Alignment:
| Q |
14 |
caaaggatagagagattggagtcagggatgcaaatgtcacaaagaatgaaaaatgctggttactttagtgttccattttgtgaggaaactgttttggaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37603808 |
caaaggatagagagattggagtcagggatgcaaatgtcacaaagaatgaaaaatgctggttactttagcgttccattttgtgaggaaactgttttggaag |
37603907 |
T |
|
| Q |
114 |
ttaagggtttgcttgatgaacatgctagtggatggggaatgaaaagagaagaaagcatgttggttcttacatggaaaggaaatagttgtgtgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37603908 |
ttaagggtttgcttgatgaacatgctagtggatggggaatgaaaagagaagaaagcatgttggttcttacatggaaaggaaatagttgtgtgt |
37604000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University