View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19506_high_1 (Length: 508)
Name: NF19506_high_1
Description: NF19506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19506_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-104
Query Start/End: Original strand, 18 - 328
Target Start/End: Original strand, 45905731 - 45906034
Alignment:
| Q |
18 |
caaatgcatttaaatgattagttaattaggttacttaattcgttgcgaaagtagtgagtgaaattaatactagttcaattttcaaaaataaatttgaggc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45905731 |
caaatgcatttaaatgattagttaattaggttacttaattcgttgcgaaagtagtgagtgaaattaatactagttcaattttcaaaaataaatttgaggc |
45905830 |
T |
 |
| Q |
118 |
cnnnnnnnngaagtaaaatgaatcatatatcatgcaacctagacagactctttcatttgcttttacaatgactgaatctttgaataacttcnnnnnnnnn |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45905831 |
caaaaaaaa-aagtaaaatgaatcatatatcatgcaacctagacagactctttcatttgcttttacaacgactgaatctttgaataacttc--ttttttt |
45905927 |
T |
 |
| Q |
218 |
nagtaagcaaaatatattnnnnnnnncacttaaccaagcaaaagatgtgcgaagaataatagatcaaagtatacaacaacactttgaataaattccacat |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45905928 |
tagtaagcaaaatatatt-aaaaaaacacttaaccaagcaaaagatgtgcgaag---aatagatcaaagtatacaacaacactttgaataacttccacat |
45906023 |
T |
 |
| Q |
318 |
acatgcaacac |
328 |
Q |
| |
|
||||||||||| |
|
|
| T |
45906024 |
acatgcaacac |
45906034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University