View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19506_high_11 (Length: 250)
Name: NF19506_high_11
Description: NF19506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19506_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 231
Target Start/End: Original strand, 2522451 - 2522669
Alignment:
| Q |
13 |
aatatatcaaaaacacaaaatgttagcattgatataataacattaggaaaacataaatattcataaataatatctaaactatccaattgcaaacgttatc |
112 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2522451 |
aatatatcaaaaacgcaaaatgttagcattgatataataacattagtaaaacataaatatgcataaataatatctaaactatccaattgcaaactttatc |
2522550 |
T |
 |
| Q |
113 |
atcacaagatatgtaatagttaaacaaacctggttcaaggtttcctttatcatttcttgtgcaatttcaatttgcctcttatcaccagtaacttggacag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2522551 |
atcacaagatatgtaatagttaaacaaacctggttcaaggtttcctttatcatttcttgtgcaatttcaatttgcctcttatcaccagtaacttggacag |
2522650 |
T |
 |
| Q |
213 |
tcctttctttagaatcatc |
231 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2522651 |
tcctttctttagaatcatc |
2522669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 16 - 232
Target Start/End: Original strand, 1768443 - 1768658
Alignment:
| Q |
16 |
atatcaaaaacacaaaatgttagcattgatataataacattaggaaaacataaatattcataaataatatctaaactatccaattgcaaacgttatcatc |
115 |
Q |
| |
|
|||||||| || ||||| ||| ||||||||||||||| ||| | ||||| |||||| || ||||||||| ||||||||| |||||||||| |||| ||| |
|
|
| T |
1768443 |
atatcaaatacgcaaaaagttggcattgatataataatattggtaaaacggaaatatgcacaaataatatttaaactatcaaattgcaaactttataatc |
1768542 |
T |
 |
| Q |
116 |
acaagatatgtaatagttaaacaaacctggttcaaggtttcctttatcatttcttgtgcaatttcaatttgcctcttatcaccagtaacttggacagtcc |
215 |
Q |
| |
|
|||| |||||| || |||||||||||| ||||| ||| |||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1768543 |
acaatgtatgtac-agccaaacaaacctggctcaagacttcttttatcatctcttgcgcaatttcaatttgcctcttgtcaccagtaacttggacagtcc |
1768641 |
T |
 |
| Q |
216 |
tttctttagaatcatca |
232 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
1768642 |
tttccttagaatcatca |
1768658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University