View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19506_high_6 (Length: 374)

Name: NF19506_high_6
Description: NF19506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19506_high_6
NF19506_high_6
[»] chr1 (1 HSPs)
chr1 (19-354)||(18714658-18714993)
[»] chr4 (2 HSPs)
chr4 (32-159)||(46609956-46610083)
chr4 (32-165)||(6519328-6519461)
[»] chr5 (2 HSPs)
chr5 (32-356)||(12237613-12237941)
chr5 (243-354)||(9594768-9594879)
[»] chr8 (1 HSPs)
chr8 (32-123)||(25720710-25720801)
[»] chr2 (2 HSPs)
chr2 (112-164)||(20122861-20122913)
chr2 (231-267)||(33412252-33412288)


Alignment Details
Target: chr1 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 19 - 354
Target Start/End: Original strand, 18714658 - 18714993
Alignment:
19 aacacacggtgcaggaggtggttattacatccttctcatcgttacacagtgcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
18714658 aacacacggtgcaggaggtggttattacatccttctcatcgttacacagttcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggt 18714757  T
119 cgatggtagttgatgtatggcacaagtttatcccttcaaaggtgtctgtttgtggcgcttcctacagaatagattgcccacacgagataatttggtgcgg 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||    
18714758 cgatggtagttgatgtatggcacaagtttatcccttcaaaggtgtctgttcgtggcgcttcctacggaatagattgcccacacgagataatttggtgcgg 18714857  T
219 cgacgtgctctgctgatatcagactcggtttgtgtgtttggttgcggtgaaccagaaaccgcatcccatttattttttggttgcaacacttttagtttgc 318  Q
    ||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18714858 cgacgtgctttgctgatatctgactcggtttgtgtgtttggttgcggtgaaccagaaaccgcatcccatttattttttggttgcaacacttttagtttgc 18714957  T
319 tttggtcccatgtgttacattggatgggtctttctg 354  Q
    ||||||||||||||||||||||||||||||||||||    
18714958 tttggtcccatgtgttacattggatgggtctttctg 18714993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 32 - 159
Target Start/End: Complemental strand, 46610083 - 46609956
Alignment:
32 ggaggtggttattacatccttctcatcgttacacagtgcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggtcgatggtagttga 131  Q
    ||||||||||| |||||||||||||| ||||||| |||||||| |||||| |||||||||||||||| |||||||||||| | ||||||||||||| |||    
46610083 ggaggtggttactacatccttctcatggttacacggtgcgggaagcttaccactttctcaccaacaacggtaacccggtgtataggtcgatggtagatga 46609984  T
132 tgtatggcacaagtttatcccttcaaag 159  Q
    ||||||||| |||| ||| |||||||||    
46609983 tgtatggcataagtatattccttcaaag 46609956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 32 - 165
Target Start/End: Complemental strand, 6519461 - 6519328
Alignment:
32 ggaggtggttattacatccttctcatcgttacacagtgcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggtcgatggtagttga 131  Q
    |||||||| | ||| |||||||| || ||||||  |||||||| ||||||  |||||||||  |||| |||| |||| |||||| ||||| ||| | |||    
6519461 ggaggtggcttttaaatccttctaatggttacaaggtgcgggaagcttactgctttctcacttacaacggtagcccgatggacaagtcgacggtggatga 6519362  T
132 tgtatggcacaagtttatcccttcaaaggtgtct 165  Q
    ||| ||||| |||  ||| |||||||||||||||    
6519361 tgtttggcataagagtattccttcaaaggtgtct 6519328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 60; Significance: 2e-25; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 32 - 356
Target Start/End: Original strand, 12237613 - 12237941
Alignment:
32 ggaggtggttattacatccttctcatcgttacacagtgcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggtcgatggtagttga 131  Q
    |||| ||||||||||||||||||||| |||||||||| |||||| | ||    |||||||| ||||||||||||| ||||| ||||||| |||||| |||    
12237613 ggagatggttattacatccttctcatggttacacagtacgggagtcatatcgttttctcacaaacaatggtaacctggtgggcaggtcgttggtagatga 12237712  T
132 tgtatggcacaagtttatcccttcaaaggtgtctgttt----gtggcgcttcctacagaatagattgcccacacgagataatttggtgcggcgacgtgct 227  Q
    ||| ||||| |||| ||||||||| ||||| ||| | |    ||||||| | ||   ||| | |||| | ||  ||||||||||||| | |||||| |||    
12237713 tgtgtggcataagtctatcccttcgaaggtatctttgttcgcgtggcgccttctctggaacaaattgtctactagagataatttggttcagcgacgagct 12237812  T
228 ctgctgatatcagactcggtttgtgtgtttggttgcggtgaaccagaaaccgcatcccatttattttttggttgcaacacttttagtttgctttggtccc 327  Q
     |||| |||||  || | ||||| |||| ||| |||||| || ||||||| ||   ||||||||| |||||||| || || || |   | |||||||| |    
12237813 ttgcttatatctcacgctgtttgcgtgtctggctgcggtcaaacagaaactgcggtccatttattctttggttgtaatacgttcaacgtactttggtcgc 12237912  T
328 atgtgttacattggatgggtctttctgtg 356  Q
    |||||||||| ||| ||||||| ||||||    
12237913 atgtgttacaatggttgggtctctctgtg 12237941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 243 - 354
Target Start/End: Original strand, 9594768 - 9594879
Alignment:
243 tcggtttgtgtgtttggttgcggtgaaccagaaaccgcatcccatttattttttggttgcaacacttttagtttgctttggtcccatgtgttacattgga 342  Q
    ||||||||||| | ||||||||||||| || |||||| | |||||||||||||| ||||||||| | | |||||||||||| | |||||||||||||||     
9594768 tcggtttgtgtatctggttgcggtgaatcaaaaaccgtagcccatttattttttagttgcaacattctcagtttgctttggactcatgtgttacattggt 9594867  T
343 tgggtctttctg 354  Q
    || |||| ||||    
9594868 tgagtctctctg 9594879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 32 - 123
Target Start/End: Original strand, 25720710 - 25720801
Alignment:
32 ggaggtggttattacatccttctcatcgttacacagtgcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggtcgatg 123  Q
    ||||||||||| || ||||||||||| ||||||| ||  |||| ||||||  |||||| ||||| |||||||||   ||||| |||||||||    
25720710 ggaggtggttactagatccttctcatggttacacggttagggaagcttaccgctttcttaccaataatggtaactttgtggataggtcgatg 25720801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 112 - 164
Target Start/End: Original strand, 20122861 - 20122913
Alignment:
112 gacaggtcgatggtagttgatgtatggcacaagtttatcccttcaaaggtgtc 164  Q
    ||||||||| |||| | |||||| |||||||||||||| || |||||||||||    
20122861 gacaggtcgttggttgatgatgtgtggcacaagtttattccctcaaaggtgtc 20122913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 231 - 267
Target Start/End: Original strand, 33412252 - 33412288
Alignment:
231 ctgatatcagactcggtttgtgtgtttggttgcggtg 267  Q
    |||||| ||||||||||||||||||| ||||||||||    
33412252 ctgatagcagactcggtttgtgtgttaggttgcggtg 33412288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University