View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19506_high_9 (Length: 303)
Name: NF19506_high_9
Description: NF19506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19506_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 295
Target Start/End: Original strand, 42820445 - 42820724
Alignment:
| Q |
18 |
cgaatcacttctcaggtgttatatatttataatactataaagtttgtgtttggcaaatggcattatcaa-gctgnnnnnnnn-aattgattggttccaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
42820445 |
cgaatcacttctcaggtgttatatatttataatactataaagtttgtgtttggcaaatggcattatcaaagctgtttttttttaattgattggttccaaa |
42820544 |
T |
 |
| Q |
116 |
tttttgttaactaattaagctcacattcactaggaatttgtacaaataaaaatgtaagtaatagaatgataagttgacctgaattggctcttgctattta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42820545 |
tttttgttaactaattaagctcacattcactaggaatttgtacaaataaaaatgtaagtaatagaatgataagttgacctgaattggctcttgctattta |
42820644 |
T |
 |
| Q |
216 |
gaactggccacaagtaacatcaaatattggtgaccccctgcttgctggaatatttgtgattgtgatcaatggcctttgct |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42820645 |
gaactggccacaagtaacatcaaatattggtgaccccctgcttgctggaatatttgtgattgtgatcaatggcttttgct |
42820724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University