View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19506_low_14 (Length: 213)
Name: NF19506_low_14
Description: NF19506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19506_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 10498458 - 10498597
Alignment:
| Q |
1 |
gaatataatagcaa--ctcttaaccaattattgcatgacacatagtaccatagctcactcaatattttcatctaccattaaatatccttcaaatcaaaga |
98 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10498458 |
gaatataatagcaaaactctcaaccaattattgcatgacacatagtaccatagctcactcaatattttcatctaccattaaatatccttcaaatcaaaga |
10498557 |
T |
 |
| Q |
99 |
ggaaagttacaaaaccttatgtctagtgtctcctctttcc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10498558 |
ggaaagttacaaaaccttatgtctagtgtctcctctttcc |
10498597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 184 - 213
Target Start/End: Original strand, 10498643 - 10498672
Alignment:
| Q |
184 |
gtagtaccatgtttcagattcccaacaacc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10498643 |
gtagtaccatgtttcagattcccaacaacc |
10498672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University