View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19506_low_16 (Length: 204)
Name: NF19506_low_16
Description: NF19506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19506_low_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 42553268 - 42553065
Alignment:
| Q |
1 |
acgaagctagggtttatctctctcaatcaaaatcgaactccattttccgctcaaattttaatctcaggcgaaaatggagcaagaaccagcaatggagcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42553268 |
acgaagctagggtttatctctctcaatcaaaatcgaactccattttccgctcaaattttcatctcaggcgaaaatggagcaagaaccagcaatggagcag |
42553169 |
T |
 |
| Q |
101 |
caatcaacaacactcggaaaacgaagtgaaccggaaccggtgtccaccgccgacggcggcgacacttcttcgcaaccnnnnnnntgccgcagttcagaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
42553168 |
gaatcaacaacactcggaaaacgaagtgaaccggaaccggtttccaccgccgacggcggcgacacttcttcacaaccaaaaaaatgccgcagttcagaat |
42553069 |
T |
 |
| Q |
201 |
gcac |
204 |
Q |
| |
|
|||| |
|
|
| T |
42553068 |
gcac |
42553065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University