View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19506_low_7 (Length: 333)
Name: NF19506_low_7
Description: NF19506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19506_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 16 - 317
Target Start/End: Complemental strand, 32370359 - 32370057
Alignment:
| Q |
16 |
atctaaaatcagaggcagtggcagaaaataccattataaacgagaatgtttcgagaagcatccactaaaggctgaacaagcggaacggttcccctaagct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32370359 |
atctaaaatcagaggcagtggcagaaaataccattatagacgagaatgtttcgagaagcatccactaaaggctgaacaagcggaacggttcccctaagct |
32370260 |
T |
|
| Q |
116 |
gcaaagttgcaccgatgaaatgaagttctccgttactatcttcatttgccgaacacaataacgtttcgttgtgttctataaaggatgagatttggttttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
32370259 |
gcaaagttgcaccgatgaaatgaagttctccgttgctatcttcatttgccgaacacaataacgtttcgtcgtgttctataaaggatgagatttgtttttc |
32370160 |
T |
|
| Q |
216 |
attgtgttgcagagtaactttcttcacacccaagctatcaggacc-cttctccgcagagcttctttcaggtcatctaaagagatcaacaactgcaccaaa |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32370159 |
attgtgttgcagagtaactttcttcacacccaagctatcaggacctcttctccgcagagcttctttcaggtcatctaaagaaatcaacaactgcaccaaa |
32370060 |
T |
|
| Q |
315 |
tca |
317 |
Q |
| |
|
||| |
|
|
| T |
32370059 |
tca |
32370057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University