View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19507_high_22 (Length: 306)
Name: NF19507_high_22
Description: NF19507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19507_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 5 - 293
Target Start/End: Original strand, 10596514 - 10596802
Alignment:
| Q |
5 |
gagagagatgaatgatgccaaagagaatgtgacnnnnnnngactctaactcgatgagtaaacgacaatcaacatctccgcctaagggatccaagttacct |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
10596514 |
gagagaaatgaatgatgccaaagagaatgtgacaaaaaaagactctaactcgatgagtaaacgacgaccaacatctccgcctaagggatccaagttacct |
10596613 |
T |
 |
| Q |
105 |
cctgtttgtctgagagttgatccattgccaaggaagaaaaatggaaatggaagttcaaggtctccaagtccacctgcttcaaaagaacactcgaaagcaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10596614 |
cctgtttgtctgagagttgatccattgccaaggaagaaaaatggaaatgggagttcaaggtctccaagtccacctgcttcaaaagaacacttgaaagcaa |
10596713 |
T |
 |
| Q |
205 |
catctgttgaatcaaagaacattcctttgagagacatcaaagacaggattgaaccaaattcaaatggtaagagtgcatcaaaggctagt |
293 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
10596714 |
catcttttggatcaaagaacattcctttgagagacatcaaagacaggactgaaccaaattcagatagtaagagtgcaccaaaggctagt |
10596802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University