View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19507_low_16 (Length: 347)
Name: NF19507_low_16
Description: NF19507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19507_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 3451444 - 3451114
Alignment:
| Q |
1 |
catggaagcacatgtcgtaacaaatgttcttgcgaaaaccatttgggtctttttacagctattcttttatgcatttcgaccgttgtttcttaaaccgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451444 |
catggaagcacatgtcgtaacaaatgttcttgcgaaaaccatttgggtctttttacagctattcttttatgcatttcgaccgttgtttcttaaaccgaaa |
3451345 |
T |
 |
| Q |
101 |
cctccaggtatttgggaattcatcaacttctctgttcagattgcccttgatgtctcaatggtttatttctggggttggaaatccttagcttatctcatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451344 |
cctccaggtatttgggaattcatcaacttctctgttcagattgcccttgatgtctcaatggtttatttctggggttggaaatccttagcttatctcatac |
3451245 |
T |
 |
| Q |
201 |
ttgccacatttgttggtggaggaatgcatccaatggctggtcacttcatttcagaacattatgtattcaatcctgaacaagagacatattcttactacgg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3451244 |
ttgccacatttgttggtggaggaatgcatccaatggctggtcacttcatttcagaacattatgtattcaatcctgaacaagagacatattcttactatgg |
3451145 |
T |
 |
| Q |
301 |
acctctgaatcttctcacatggcatgtaggt |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3451144 |
acctctgaatcttctcacatggcatgtaggt |
3451114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University