View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19507_low_25 (Length: 290)
Name: NF19507_low_25
Description: NF19507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19507_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 502803 - 502709
Alignment:
| Q |
1 |
tgcaccttaaaaaatgatgtcctggactgccacccttcccacccaccctcaaggtcatagataatgtaaagttattagtggaacatatttattga |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
502803 |
tgcaccttaaaaaatgatgtcctggactgccacccttcccacccaccctaagggtcatagataatgtaaagttattagtggaacatatttattga |
502709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 174 - 273
Target Start/End: Complemental strand, 502678 - 502591
Alignment:
| Q |
174 |
gacgacctacaaaagtttttccaagtcaacccgtatttatgcttgtttgtttatttgtttgtgaaattagtatgtttaacttataggttactccttttgt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| || || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
502678 |
gacgacctacaaaagtttttccaagtcaatccgtatttatgctttttcgt------------gaaattagtatgtttaacttataggttactccttttgt |
502591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University