View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19507_low_26 (Length: 289)
Name: NF19507_low_26
Description: NF19507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19507_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 227
Target Start/End: Original strand, 30577218 - 30577435
Alignment:
| Q |
12 |
atgaaaccctaaaacagaaatgaaaaaagaaattaaaatgaagagataccttgtagccgagatcgatggtgtattgagctttggattgaaggtagcgaca |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30577218 |
atgaaaccctaaaagagaaatgaaaaaagaaattaaaatgaagagataccttgtagccgagatcgatggtgtattgagctttggattgaaggtagcgaca |
30577317 |
T |
|
| Q |
112 |
ccacgttgtgaaggaaaccattgttggagaacaaaaacaacacctct--actctctacgttaaaccccccaaaaaatgtagaacttgtgatttctcggag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30577318 |
ccacgttgtgaaggaaaccattgttggagaacaaaaacaacacctctacactctctacgttaaaccccccaaaaaatgtagaacttgtgatttctcggag |
30577417 |
T |
|
| Q |
210 |
tataacgtggcagatatt |
227 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30577418 |
tataacgtggcagatatt |
30577435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University