View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19507_low_26 (Length: 289)

Name: NF19507_low_26
Description: NF19507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19507_low_26
NF19507_low_26
[»] chr1 (1 HSPs)
chr1 (12-227)||(30577218-30577435)


Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 227
Target Start/End: Original strand, 30577218 - 30577435
Alignment:
12 atgaaaccctaaaacagaaatgaaaaaagaaattaaaatgaagagataccttgtagccgagatcgatggtgtattgagctttggattgaaggtagcgaca 111  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30577218 atgaaaccctaaaagagaaatgaaaaaagaaattaaaatgaagagataccttgtagccgagatcgatggtgtattgagctttggattgaaggtagcgaca 30577317  T
112 ccacgttgtgaaggaaaccattgttggagaacaaaaacaacacctct--actctctacgttaaaccccccaaaaaatgtagaacttgtgatttctcggag 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
30577318 ccacgttgtgaaggaaaccattgttggagaacaaaaacaacacctctacactctctacgttaaaccccccaaaaaatgtagaacttgtgatttctcggag 30577417  T
210 tataacgtggcagatatt 227  Q
    ||||||||||||||||||    
30577418 tataacgtggcagatatt 30577435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University