View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19507_low_36 (Length: 251)
Name: NF19507_low_36
Description: NF19507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19507_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 235
Target Start/End: Complemental strand, 44361060 - 44360837
Alignment:
| Q |
12 |
ataggagtattattaagataactaaagaggtatgacaaattaaattagtggagatggaaaaatgggtgtgtttgatgatgatgttggtagcaatattgga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44361060 |
ataggagtattattaagataactaaagaggtgtgacaaattaaattagtggagatggaaaaatgggtgtgtttgatgatgatgttggtagcaatattgga |
44360961 |
T |
 |
| Q |
112 |
attaagttttggagtcaaaggtgcagaagaggtaacatatgatggaagatcccttatcatcaatggacaaagaaatattctcttctctggttctattcat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44360960 |
attaagttttggagtcaaaggtgcagaagaggtaacatatgatggaagatctcttatcatcaatggacaaagaaatattctcttctctggttctattcat |
44360861 |
T |
 |
| Q |
212 |
tacccccgtagcacccctcaggta |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44360860 |
tacccccgtagcacccctcaggta |
44360837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 235
Target Start/End: Original strand, 40097571 - 40097615
Alignment:
| Q |
191 |
ctcttctctggttctattcattacccccgtagcacccctcaggta |
235 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||| ||||||||| |
|
|
| T |
40097571 |
ctcttctctggttcaattcattatcctcgtagcactcctcaggta |
40097615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University