View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19507_low_37 (Length: 250)
Name: NF19507_low_37
Description: NF19507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19507_low_37 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 3451676 - 3451434
Alignment:
| Q |
8 |
agataattctagtagcctannnnnnnggctcattcctcaaccacaacctcttcttggctatccatgagctcagtcacaatcttgctttttcaactccagt |
107 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451676 |
agatacttctagtagcctatttttttggctcattcctcaaccacaacctcttcttggctatccatgagctcagtcacaatcttgctttttcaactccagt |
3451577 |
T |
|
| Q |
108 |
ttacaaccgttggcttgggattttcgctaatctccctataggcgtacctatgtccgtaaccttccaaaagtatcacttggagcaccatcgcttccaaggc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451576 |
ttacaaccgttggcttgggattttcgctaatctccctataggcgtacctatgtccgtaaccttccaaaagtatcacttggagcaccatcgcttccaaggt |
3451477 |
T |
|
| Q |
208 |
gtcgatggtgttgatatggatatccctagtcacatggaagcac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451476 |
gtcgatggtgttgatatggatatccctagtcacatggaagcac |
3451434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University