View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19507_low_39 (Length: 246)
Name: NF19507_low_39
Description: NF19507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19507_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 10 - 223
Target Start/End: Complemental strand, 4546883 - 4546674
Alignment:
| Q |
10 |
ttaattgaaagtaatcacatcacacatgtcagacacgagacgaaactaaccggcgtgggttgagagagaagaagcacgttgtgtaagaataacacgcaaa |
109 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4546883 |
ttaattgaaagtaa----atcacacatgtcagacacgaaactaaactaaccggcgtgggttgagagagaagaagcacgttgtgtaagaataacacgcaaa |
4546788 |
T |
 |
| Q |
110 |
ttcccatcttgaccttcgaataaacaaataagaaccgctgctctcttgttttgtttgtaaattgaagtttctttgagtggattggtgttggaaggtgatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4546787 |
ttcccatcttgaccttcgaataaacaaataagaaccgctgctctcttgttttgtttgtaaattgaagtttcttttagtggattggtgttggaaggtgatt |
4546688 |
T |
 |
| Q |
210 |
taaggtgatcaagt |
223 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
4546687 |
taaggtgatgaagt |
4546674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University