View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19507_low_46 (Length: 201)

Name: NF19507_low_46
Description: NF19507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19507_low_46
NF19507_low_46
[»] chr1 (1 HSPs)
chr1 (1-133)||(36823718-36823850)


Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 36823718 - 36823850
Alignment:
1 taaatcgattagttcaaaatgaaaactagcttaggctgccctctcctccttatgtgaatgttaaaagaaatgacaacaatatatacccttgaggtcttgg 100  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||    
36823718 taaatcgattagttcaaaatgaaaaccagcttaggctgccctctcctccttctgtgaatgttaaaagaaatgacaacaatatatactcttgaggtctagg 36823817  T
101 tagaactcctctcggtcaaataactacattaat 133  Q
    ||||||||||||||||||||||||||| |||||    
36823818 tagaactcctctcggtcaaataactacgttaat 36823850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University