View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19507_low_46 (Length: 201)
Name: NF19507_low_46
Description: NF19507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19507_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 36823718 - 36823850
Alignment:
| Q |
1 |
taaatcgattagttcaaaatgaaaactagcttaggctgccctctcctccttatgtgaatgttaaaagaaatgacaacaatatatacccttgaggtcttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
36823718 |
taaatcgattagttcaaaatgaaaaccagcttaggctgccctctcctccttctgtgaatgttaaaagaaatgacaacaatatatactcttgaggtctagg |
36823817 |
T |
 |
| Q |
101 |
tagaactcctctcggtcaaataactacattaat |
133 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
36823818 |
tagaactcctctcggtcaaataactacgttaat |
36823850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University