View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19508_high_6 (Length: 239)
Name: NF19508_high_6
Description: NF19508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19508_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 5021342 - 5021128
Alignment:
| Q |
18 |
aggaaaggtgtggttcgactttttgcatcctgtcctacaacgtataaaaattcagcaactagcccctcaactgtaacccttgtagatgaatccttcattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5021342 |
aggaaaggtgtggttcgactttttgcatcctgtcctacaacgtataaaaattcagcaactagcccctcaactgtaacccttgtagaagaatccttcattc |
5021243 |
T |
|
| Q |
118 |
caacagatgatcttaacttctcacagagcttcagaaatgcttgagggctcatgcgaataatgtgccgacatttttcagtttgtactaactgtgccattaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5021242 |
caacagatgatcttaacttctcacagagcttcagaaatgcttgagggctcatgcgaataatgcgccgacatttttcagtttgtactaactgtgccattaa |
5021143 |
T |
|
| Q |
218 |
ttgaacagacctatg |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5021142 |
ttgaacagacctatg |
5021128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 66 - 230
Target Start/End: Complemental strand, 5018592 - 5018431
Alignment:
| Q |
66 |
aattcagcaactagcccctcaactgtaacccttgtagatgaatccttcattccaacagatgatcttaacttctcacagagcttcagaaatgcttgagggc |
165 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||| |||||||||||||| | ||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
5018592 |
aattcagcaacttgcccctcaactgtaacccctgt---tgaatccttcattctaccagatgaccttaatttctcacaaagcttcagaaatgcttgagggc |
5018496 |
T |
|
| Q |
166 |
tcatgcgaataatgtgccgacatttttcagtttgtactaactgtgccattaattgaacagaccta |
230 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| ||||| ||||||||| | ||||||||||||| |
|
|
| T |
5018495 |
tcatgcgaatgatgtctcggcatttttcagtttctactagctgtgccatcagttgaacagaccta |
5018431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University