View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19508_low_6 (Length: 262)
Name: NF19508_low_6
Description: NF19508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19508_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 65 - 240
Target Start/End: Complemental strand, 49952094 - 49951913
Alignment:
| Q |
65 |
catcatcaagatatggaagggacattgaattggggaaggagctattcaggagg------aggaggacagcagcatcgtttagatacaaatactcctaatt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49952094 |
catcatcaagatatggaagggacattgaattggggaaggagctattcaggaggtggaggaggaggacagcagcatcgtttagatacaaatactcctaatt |
49951995 |
T |
|
| Q |
159 |
cagcagcattgatcaatcggtttcaagatggtttctaatgagagtgagagagagattctgtgtgtgattgtgttgatctgtt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49951994 |
cagcagcattgatcaatcggtttcaagatggtttctaatgagagtgagagagagattctgtgtgtgattgtgttgatctgtt |
49951913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University