View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19509_high_10 (Length: 221)
Name: NF19509_high_10
Description: NF19509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19509_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 16 - 95
Target Start/End: Complemental strand, 23664673 - 23664594
Alignment:
| Q |
16 |
atatctgatacaagatttgaagtaataatcaatcgttgtccttagtgaaaaatcatttccatctacatggatatcataaa |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23664673 |
atatctgatacaagatttgaagtaataatcaatcgttgtccttagtgaaaaatcatttccatctacatggatatcataaa |
23664594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 118 - 197
Target Start/End: Original strand, 23702119 - 23702198
Alignment:
| Q |
118 |
tttagcacttgaaagtctcacttgctgtgcaaaatttcttagtaaattgctaggatagaagatagaggagacgttagtta |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23702119 |
tttagcacttgaaagtctcacttggtgtgcaaaatttcttagtaaattgctaggatagaagatagaggagacgttagtta |
23702198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 104 - 197
Target Start/End: Complemental strand, 23663855 - 23663753
Alignment:
| Q |
104 |
gtacattgtttgattttagcacttgaaagtctcacttgctgtgcaaaatttcttagtaa---------attgctaggatagaagatagaggagacgttag |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| || |||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
23663855 |
gtacattgtttgattttagcacttgaaagtctcacttggtgtgcaatcttccttagtaaattactacgattgctagaatagaagatagaggagatgttag |
23663756 |
T |
 |
| Q |
195 |
tta |
197 |
Q |
| |
|
||| |
|
|
| T |
23663755 |
tta |
23663753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University