View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19509_high_11 (Length: 217)
Name: NF19509_high_11
Description: NF19509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19509_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 49 - 97
Target Start/End: Complemental strand, 47551884 - 47551836
Alignment:
| Q |
49 |
aattttgagagagatatttaaagttatttgaatacgatcaactcccgtg |
97 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47551884 |
aattttgagagagatgtttaaagttatttgaatacgatcaactcccgtg |
47551836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 200
Target Start/End: Complemental strand, 47551779 - 47551733
Alignment:
| Q |
154 |
ttatttttatcgtaatttatcttgatgtgatgatggtgataaattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47551779 |
ttatttttatcgtaatttatcttgatatgatgatggtgataaattaa |
47551733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University