View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19509_high_5 (Length: 316)

Name: NF19509_high_5
Description: NF19509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19509_high_5
NF19509_high_5
[»] chr5 (2 HSPs)
chr5 (198-298)||(4914461-4914561)
chr5 (13-189)||(4914590-4914768)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 198 - 298
Target Start/End: Complemental strand, 4914561 - 4914461
Alignment:
198 tgacatatttacttatttatgaggaaaatgacatatatttattgataaaatataaaatatggaagaaatttgctcgttggaaattatttagaccaataga 297  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4914561 tgacatatttacttatttatgaggaaaatgacatatatttattgataaaatataaaatatggaagaaatttgctcgttggaaattatttagaccaataga 4914462  T
298 c 298  Q
    |    
4914461 c 4914461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 13 - 189
Target Start/End: Complemental strand, 4914768 - 4914590
Alignment:
13 aatattggtaaaaaagaaatatgaataatgtcccgtcnnnnnnnn-taatgctgtcttgacgtaacgtgatatggtccataaacttttgtttgnnnnnnn 111  Q
    ||||||||||||||| |||||||||||||||||||||         |||||||||||||||||||| |||||||||||||||||||||| |||           
4914768 aatattggtaaaaaa-aaatatgaataatgtcccgtcaaaaaaaaataatgctgtcttgacgtaacatgatatggtccataaacttttgcttgaaaaaaa 4914670  T
112 tggtccataaactttcagccatg--annnnnnnaagaaacataagcttacagccacaacaatgacatatttacttctctc 189  Q
    |||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||||||||    
4914669 tggtccataaactttcagccatgttttttttttaagaaacataagcttacagccacaacaatgacatatttacttctctc 4914590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University