View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19509_high_5 (Length: 316)
Name: NF19509_high_5
Description: NF19509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19509_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 198 - 298
Target Start/End: Complemental strand, 4914561 - 4914461
Alignment:
| Q |
198 |
tgacatatttacttatttatgaggaaaatgacatatatttattgataaaatataaaatatggaagaaatttgctcgttggaaattatttagaccaataga |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4914561 |
tgacatatttacttatttatgaggaaaatgacatatatttattgataaaatataaaatatggaagaaatttgctcgttggaaattatttagaccaataga |
4914462 |
T |
 |
| Q |
298 |
c |
298 |
Q |
| |
|
| |
|
|
| T |
4914461 |
c |
4914461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 13 - 189
Target Start/End: Complemental strand, 4914768 - 4914590
Alignment:
| Q |
13 |
aatattggtaaaaaagaaatatgaataatgtcccgtcnnnnnnnn-taatgctgtcttgacgtaacgtgatatggtccataaacttttgtttgnnnnnnn |
111 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
4914768 |
aatattggtaaaaaa-aaatatgaataatgtcccgtcaaaaaaaaataatgctgtcttgacgtaacatgatatggtccataaacttttgcttgaaaaaaa |
4914670 |
T |
 |
| Q |
112 |
tggtccataaactttcagccatg--annnnnnnaagaaacataagcttacagccacaacaatgacatatttacttctctc |
189 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4914669 |
tggtccataaactttcagccatgttttttttttaagaaacataagcttacagccacaacaatgacatatttacttctctc |
4914590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University