View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19509_low_11 (Length: 221)

Name: NF19509_low_11
Description: NF19509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19509_low_11
NF19509_low_11
[»] chr1 (3 HSPs)
chr1 (16-95)||(23664594-23664673)
chr1 (118-197)||(23702119-23702198)
chr1 (104-197)||(23663753-23663855)


Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 16 - 95
Target Start/End: Complemental strand, 23664673 - 23664594
Alignment:
16 atatctgatacaagatttgaagtaataatcaatcgttgtccttagtgaaaaatcatttccatctacatggatatcataaa 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23664673 atatctgatacaagatttgaagtaataatcaatcgttgtccttagtgaaaaatcatttccatctacatggatatcataaa 23664594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 118 - 197
Target Start/End: Original strand, 23702119 - 23702198
Alignment:
118 tttagcacttgaaagtctcacttgctgtgcaaaatttcttagtaaattgctaggatagaagatagaggagacgttagtta 197  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23702119 tttagcacttgaaagtctcacttggtgtgcaaaatttcttagtaaattgctaggatagaagatagaggagacgttagtta 23702198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 104 - 197
Target Start/End: Complemental strand, 23663855 - 23663753
Alignment:
104 gtacattgtttgattttagcacttgaaagtctcacttgctgtgcaaaatttcttagtaa---------attgctaggatagaagatagaggagacgttag 194  Q
    |||||||||||||||||||||||||||||||||||||| |||||||  || ||||||||         |||||||| ||||||||||||||||| |||||    
23663855 gtacattgtttgattttagcacttgaaagtctcacttggtgtgcaatcttccttagtaaattactacgattgctagaatagaagatagaggagatgttag 23663756  T
195 tta 197  Q
    |||    
23663755 tta 23663753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University