View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19509_low_12 (Length: 217)

Name: NF19509_low_12
Description: NF19509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19509_low_12
NF19509_low_12
[»] chr1 (2 HSPs)
chr1 (49-97)||(47551836-47551884)
chr1 (154-200)||(47551733-47551779)


Alignment Details
Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 49 - 97
Target Start/End: Complemental strand, 47551884 - 47551836
Alignment:
49 aattttgagagagatatttaaagttatttgaatacgatcaactcccgtg 97  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||    
47551884 aattttgagagagatgtttaaagttatttgaatacgatcaactcccgtg 47551836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 200
Target Start/End: Complemental strand, 47551779 - 47551733
Alignment:
154 ttatttttatcgtaatttatcttgatgtgatgatggtgataaattaa 200  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||    
47551779 ttatttttatcgtaatttatcttgatatgatgatggtgataaattaa 47551733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University