View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19509_low_13 (Length: 207)

Name: NF19509_low_13
Description: NF19509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19509_low_13
NF19509_low_13
[»] chr7 (1 HSPs)
chr7 (106-191)||(36019294-36019379)


Alignment Details
Target: chr7 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 106 - 191
Target Start/End: Original strand, 36019294 - 36019379
Alignment:
106 gagactaatctttctcttggtgtagacttgtactagcagattctacacatccggtctcttgtattctaagaaacatatgataaaca 191  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
36019294 gagactaatctttctcttggtgtagacttgtactggcagattctacacatccggtctcttgtattctaagaaacatatgataaaca 36019379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University