View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19509_low_13 (Length: 207)
Name: NF19509_low_13
Description: NF19509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19509_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 106 - 191
Target Start/End: Original strand, 36019294 - 36019379
Alignment:
| Q |
106 |
gagactaatctttctcttggtgtagacttgtactagcagattctacacatccggtctcttgtattctaagaaacatatgataaaca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36019294 |
gagactaatctttctcttggtgtagacttgtactggcagattctacacatccggtctcttgtattctaagaaacatatgataaaca |
36019379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University