View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1950_high_19 (Length: 202)

Name: NF1950_high_19
Description: NF1950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1950_high_19
NF1950_high_19
[»] chr1 (1 HSPs)
chr1 (1-167)||(28755411-28755569)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 28755411 - 28755569
Alignment:
1 aaaacgtagttatagctctctgtgtcatggcaatctctttgtttgacgcgtgggacgcttttatagtaatttcacgnnnnnnngttttattctaaaacta 100  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||| ||||||||||||||||       |||||||| ||||        
28755411 aaaacgtagttatagctct--gtgtcatggcaatctctttgtttgacgcgtgggacgctattatagtaatttcacgtttttttgttttattgtaaa---- 28755504  T
101 aaatttggaacgaatctttctgcttcaaaacacttggttggtcaaggaaaaaaatgtccttggtacc 167  Q
      |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
28755505 --atttggaacgaatctttctgcttctaaacacttggttggtcaaggaaaaaaatgtccttggtacc 28755569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University