View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1950_high_19 (Length: 202)
Name: NF1950_high_19
Description: NF1950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1950_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 28755411 - 28755569
Alignment:
| Q |
1 |
aaaacgtagttatagctctctgtgtcatggcaatctctttgtttgacgcgtgggacgcttttatagtaatttcacgnnnnnnngttttattctaaaacta |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
28755411 |
aaaacgtagttatagctct--gtgtcatggcaatctctttgtttgacgcgtgggacgctattatagtaatttcacgtttttttgttttattgtaaa---- |
28755504 |
T |
 |
| Q |
101 |
aaatttggaacgaatctttctgcttcaaaacacttggttggtcaaggaaaaaaatgtccttggtacc |
167 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28755505 |
--atttggaacgaatctttctgcttctaaacacttggttggtcaaggaaaaaaatgtccttggtacc |
28755569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University