View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1950_low_17 (Length: 249)
Name: NF1950_low_17
Description: NF1950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1950_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 95 - 202
Target Start/End: Original strand, 30368587 - 30368694
Alignment:
| Q |
95 |
gcatgtttcaatgtaataaactgatttagggtgaacggttgatatatannnnnnnattttaaagttataggagatgacctctccaagctaaataatacat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30368587 |
gcatgtttcaatgtaataaactgatttagggtgaacggttgatatatatttttttatttttaagttataggagatgacctctccaagctaaataatacat |
30368686 |
T |
 |
| Q |
195 |
cagagata |
202 |
Q |
| |
|
|||||||| |
|
|
| T |
30368687 |
cagagata |
30368694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 45
Target Start/End: Original strand, 30368509 - 30368537
Alignment:
| Q |
17 |
tcttggtcgaatattcttatggtctagtg |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30368509 |
tcttggtcgaatattcttatggtctagtg |
30368537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University