View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1950_low_22 (Length: 225)
Name: NF1950_low_22
Description: NF1950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1950_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 55 - 208
Target Start/End: Original strand, 46767547 - 46767699
Alignment:
| Q |
55 |
ctccaagtaagctactgcaagatgaatacgtatgaaattaaatgatcatattattgatnnnnnnnnnttaagcaccctataagctcataatttatgtttc |
154 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
46767547 |
ctccaagtaagctactgcaaggtgaatacgtatgaaattaaatgatcatattattgataaaaaaaa-ttaagcaccctataagctcataatttatgcttc |
46767645 |
T |
 |
| Q |
155 |
taaaagcagaccatttacaaaagttcctgtattttagtatagaaggaagatttt |
208 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46767646 |
taaaagcagaacatttacaaaagttcttgtattttagtatagaaggaagatttt |
46767699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University