View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1950_low_23 (Length: 216)
Name: NF1950_low_23
Description: NF1950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1950_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 5719872 - 5719965
Alignment:
| Q |
1 |
gcaagcaagcacctttcaatttgcggctacaagctgtgattagctgctcttgcacgtatagttgtttaatttatttaatgtgttttttactatc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5719872 |
gcaagcaagcacctttcaatttgcggctacaacctgtgattagctgctcttgcacgtatagttgtttaatttttttaatgtgttttttactatc |
5719965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 161 - 200
Target Start/End: Original strand, 5720032 - 5720071
Alignment:
| Q |
161 |
aaatggaaggttttgaagttaaaacttcaacggttatcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5720032 |
aaatggaaggttttgaagttaaaacttcaacggttatcat |
5720071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University