View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1950_low_26 (Length: 204)
Name: NF1950_low_26
Description: NF1950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1950_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 11 - 162
Target Start/End: Original strand, 29713167 - 29713314
Alignment:
| Q |
11 |
atcatcaatattttaggagtatgagagggaagtatcttgctcttccttccgttgtggggacatgatggttccataaggaaaggcatgcattggctgattt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29713167 |
atcaccaatattttaggagtatgagagggaagtatcttgctcttccttccgttgtggggacatgatggttccataaggaaaggcatgcattggctgattt |
29713266 |
T |
|
| Q |
111 |
gggaaagattaattgtcggttcataattttgttggtatgaattttaaagatc |
162 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29713267 |
gggaaag----attgtcggttcataattttgttggtatgaattttaaagatc |
29713314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University