View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19510_high_16 (Length: 403)
Name: NF19510_high_16
Description: NF19510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19510_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 8e-40; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 286 - 388
Target Start/End: Complemental strand, 42140732 - 42140625
Alignment:
| Q |
286 |
aattagattctttggtagtaatctagttgaattctttacttgatgtttctgaaacaattgaaggatgctagagcacgatggtt-----gtgtgcaatgct |
380 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42140732 |
aattagattatttggtagtaatctagttgaattctttacttgatgtttctgaaacaattgaaggatgctagagcacgatggttgtgttgtgtgcaatgct |
42140633 |
T |
 |
| Q |
381 |
gaaaatga |
388 |
Q |
| |
|
|||||||| |
|
|
| T |
42140632 |
gaaaatga |
42140625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 60 - 177
Target Start/End: Complemental strand, 42140994 - 42140879
Alignment:
| Q |
60 |
tagcggattaaggctttctttgatnnnnnnnngatagtaaattgttgataaactaacttatagcggttagtattannnnnnnnataaatagaaattattg |
159 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
42140994 |
tagcggattaaggctttctttgataaaaaaa-gatagtaaattgttgataaactaacttatagctgttagtatt-ttttttttataaatagaaattattg |
42140897 |
T |
 |
| Q |
160 |
gtagactcttccatcaag |
177 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42140896 |
gtagactcttccatcaag |
42140879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 270 - 301
Target Start/End: Complemental strand, 42140780 - 42140749
Alignment:
| Q |
270 |
gtttaaggcacggtataattagattctttggt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42140780 |
gtttaaggcacggtataattagattctttggt |
42140749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University