View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19510_high_7 (Length: 537)

Name: NF19510_high_7
Description: NF19510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19510_high_7
NF19510_high_7
[»] chr1 (1 HSPs)
chr1 (1-47)||(4715405-4715451)
[»] chr5 (1 HSPs)
chr5 (99-136)||(41043216-41043253)


Alignment Details
Target: chr1 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 4715405 - 4715451
Alignment:
1 cttttatattattggtggagccatagattgtggtggcaataaaattt 47  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
4715405 cttttatattattggtggagccatagattgtggtggcaataaaattt 4715451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 41043253 - 41043216
Alignment:
99 caagctgccattgactctataaagagtcaaaatgatca 136  Q
    |||||||||||||| |||||||||||||||||| ||||    
41043253 caagctgccattgattctataaagagtcaaaataatca 41043216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University