View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19510_low_36 (Length: 278)
Name: NF19510_low_36
Description: NF19510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19510_low_36 |
 |  |
|
| [»] scaffold0699 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0699 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: scaffold0699
Description:
Target: scaffold0699; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 10 - 259
Target Start/End: Complemental strand, 2974 - 2725
Alignment:
| Q |
10 |
attatactcccaagggtggtacatttaatgtccgagttgcccgaaacaattttccgttctgccnnnnnnnngttgagtttttccttaaatgtaatatttt |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
2974 |
attaaactcccaagggtggtacatttaatgtccgagttgctcgaaacaattttccgttctgccaaaaaaaagttgagtttttccttaaatgtagtatttt |
2875 |
T |
 |
| Q |
110 |
atcccaaaaaacttgtgaggttggtgnnnnnnnnntattatttgaaataaaatgagcttttttgttggacttgtgagggcaagtgaggtgcgaaggcatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2874 |
atcccaaaaaacttgtgaggttggtgaaaaaaaaagattatttgaaataaaatgagcttttttgttggacttgtgagggcaagtgaggtgcgaaggcatg |
2775 |
T |
 |
| Q |
210 |
gatttttcttcttctaagttggttggccttagaccactgtttgcagagag |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2774 |
tatttttcttcttctaagttggttggccttagaccaccgtttgcagagag |
2725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University