View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19510_low_37 (Length: 265)
Name: NF19510_low_37
Description: NF19510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19510_low_37 |
 |  |
|
| [»] scaffold0699 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0699 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: scaffold0699
Description:
Target: scaffold0699; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 2947 - 3211
Alignment:
| Q |
1 |
ttaaatgtaccacccttgggagtttaatatggccacggctagaatagtaaaaggttcgaccaaaagtaagtttgatatgatcactttaaactttagagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
2947 |
ttaaatgtaccacccttgggagtttaatatggccacggctagaatagtaaaagggtcgaccaaaggtaagtttgatatggtcactttaaactttagagta |
3046 |
T |
 |
| Q |
101 |
tttgggtgaatcggaatttgatatggtcattttagactttagaatatctgggtgaaccggaagaatgataaggtgtggaattacaatattcttgaaccct |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3047 |
tttgggtgaaccggaatttgatatggtcactttagacttcagagtatctgggtgaaccggaagaatgataaggtgtggaattacaatatttttgaaccct |
3146 |
T |
 |
| Q |
201 |
tggtggataactctatgagctcaaaaatgtggccaaaacaagtaagttagcctttaaaatgcatc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3147 |
tggtggataactctatgagctcaaaaatgaggccaaaacaagtaagttagcctttaaaatgcatc |
3211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University