View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19510_low_38 (Length: 263)
Name: NF19510_low_38
Description: NF19510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19510_low_38 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 263
Target Start/End: Complemental strand, 5462339 - 5462093
Alignment:
| Q |
17 |
actatttctggtggaactcatcatgatgcaatgcttcaattaactgcattcaaagtctcttttgccaaacatgattctattgcttcaccaccatcttcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
5462339 |
actatttctggtggaactcatcatgatgcaatgcttcaattaactgcattcaaagtctcttttgccgaacataattctattgcttcaccaccatcttcat |
5462240 |
T |
|
| Q |
117 |
tctcaccctctcctagcccttctcctatgccatcacaggtaataacttatcatctaagtcattagttaaacatggttttaaattgtggtcacggtcaggg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5462239 |
tctcaccctctcctagcccttctcctatgccgtcacaggtaataacttatcatctaagtcattagttaaacatggttttaaattgtggtcacggtcaggg |
5462140 |
T |
|
| Q |
217 |
tattaaattgcggttgctggtttggttatgctgcaaaccttcatatc |
263 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5462139 |
tattaaattgcggtcgctggtttggttatgctgcaaaccttcatatc |
5462093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University