View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19510_low_46 (Length: 225)
Name: NF19510_low_46
Description: NF19510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19510_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 4674669 - 4674861
Alignment:
| Q |
15 |
agtcaacttgagtctcgaatgtatgtttctttagttagtttgtttatcaaatgtgtactttattagttaatttggtatcggttacttgcaaaatgtgaac |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
4674669 |
agtcaactagagtctcgaatgtatgtttctttagttagtttatttattaaatgtgta-tttattagttaatttgctatcagttacttgcaaaatgtgaac |
4674767 |
T |
 |
| Q |
115 |
taannnnnnnaaaatactgatatacagatttacaggccaaaatgattccctttgcaaggaaaaatacttcattaagcaacacgagaaacagaag |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4674768 |
taattttttgaaaatactgatatacagatttacaggccaaaatgattccctttgcaaggaaaaatacttcattaagcaacacgagaaacagaag |
4674861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University