View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19511_high_21 (Length: 244)
Name: NF19511_high_21
Description: NF19511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19511_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 40109312 - 40109185
Alignment:
| Q |
1 |
gttgaattaaagttgaaaggcaagaaagaggcccgcgaggaagttgaattttggtgcgtaaatggtagtgtgaaattgacttgttatcaaacctcataca |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40109312 |
gttgaattaaagtggaaaggcaagaaagaggcccgcgaggaagttgaattttggtgcgtaaatggtagtgtgaaattgacttgttatcaaacctcataca |
40109213 |
T |
 |
| Q |
101 |
attacaatacctctctaaaccagcaaaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40109212 |
attacaatacctctctaaaccagcaaaa |
40109185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 230
Target Start/End: Complemental strand, 40109117 - 40109083
Alignment:
| Q |
196 |
tgttgctccatcctcactcttctaacctgtctctg |
230 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40109117 |
tgttgctccatcctcactcttctaatctgtctctg |
40109083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University