View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19511_low_12 (Length: 360)
Name: NF19511_low_12
Description: NF19511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19511_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 54868460 - 54868750
Alignment:
| Q |
19 |
aaacgtggatttattaattagtggttgctattgctaatctccttatagt-----tgtgaaga---tttgtcaacttgttgatacagaatggaagtagtgg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | || ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54868460 |
aaacgtggatttattaattagtggttgctattgctaatctccttataatgagaatg-gaagaccttttgtcaacttgttgatacagaatggaagtagtgg |
54868558 |
T |
 |
| Q |
111 |
tgcaacatatctatcacaaaagtaactggtggacattgatgccttagctaacttaggatgctttttgatcattgattatcggttatgatgacttatgagt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54868559 |
tgcaacatatctatcacaaaagtaactggtgtacattgatgccttagctaacttaggatgctttttgatcattga-tatcggttatgatgacttatgagt |
54868657 |
T |
 |
| Q |
211 |
catgtgtatttaaattttagtcac-----------------ttcttttttcccaagttttgccctctttataaaaactaagaaaaatgtgaag |
286 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54868658 |
catgtgtatttaaattttagtcacttgattttgttgtagttttcttttttccgaagttttgccctctttataaaaactaagaaaaatgtgaag |
54868750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 304 - 351
Target Start/End: Original strand, 54869014 - 54869061
Alignment:
| Q |
304 |
ttagattttacaatttgaacaccgcttttatttatatgtaattttctt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54869014 |
ttagattttacaatttgaacaccgcttttatttatatgtaattttctt |
54869061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University