View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19511_low_13 (Length: 349)
Name: NF19511_low_13
Description: NF19511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19511_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 3430413 - 3430072
Alignment:
| Q |
1 |
ccggcgattacatcccggagnnnnnnnccaccgcatccatcaccgtcgccgcgttgtaggacaaagaataagtcaaaattgatcaataccttgaaacgct |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3430413 |
ccggcgattacatcccggagaaaaaaaccaccgcatccatcaccgtcgccgcgttgtaggacaaagaataagtcaaaattgatcaataccttgaaacgct |
3430314 |
T |
 |
| Q |
101 |
gctcatcagcgccactgctaatttcacgaggaaatcttattcatgaagatgatgatgatg---------gtgttggtctctttgctcaatattctttcag |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3430313 |
gctcatcagcgccactgctgatttcacgaggaaatcttattcatgaagatgatgatgatgatgatgatggtgttggtctctttgctcaatattctttcag |
3430214 |
T |
 |
| Q |
192 |
aagtggaagaggaggaacacttttccgacctcaaacattttcaaatgcctttgtttcttctccttcactttttccttcctctccaaacatttactctaat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3430213 |
aagtggaagaggaggaacacttttccgacctcaaacattttcaaatgcctttgtttcttctccttcactctttccttcctctccaaacatttactctaat |
3430114 |
T |
 |
| Q |
292 |
gaggttagttaattacacttaactctactaattcatgttatc |
333 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
3430113 |
gaggttagttaattacagttaactctactaattcatgctatc |
3430072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University