View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19511_low_17 (Length: 274)
Name: NF19511_low_17
Description: NF19511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19511_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 27 - 260
Target Start/End: Original strand, 16609221 - 16609455
Alignment:
| Q |
27 |
caggcttccaaataccattacattgttccttgggaccttcgtaaccgctggagtaattgtttcggtttgaatctgcagcttttgttttctcatgtttttt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16609221 |
caggcttccaaataccattacattgttccttgggacctttgtaaccgttggagtaattgtttcggtttgaatctgcggcttttgttttctcatgtttttt |
16609320 |
T |
|
| Q |
127 |
ggaaaggtaactcttgtgctgacaagctagcagccttggggcatgactgttttgatttttc-ttggtggcatactatttctgtcaaccttttgggggact |
225 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16609321 |
gggaaggtaactcttgtgctgacaagctagcagctttggggcatgactgttctgatttttctttggtggcatactatttctgtcaacctttcgggggact |
16609420 |
T |
|
| Q |
226 |
tgttttaggatcgttgcgatctcccgattttttgc |
260 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16609421 |
tgttttaggatcattgtgatctcccgattttttgc |
16609455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 27 - 220
Target Start/End: Original strand, 2697750 - 2697945
Alignment:
| Q |
27 |
caggcttccaaataccattacattgttccttgggaccttcgtaaccgctggagtaattgtttcggt--ttgaatctgcagcttttgttttctcatgtttt |
124 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||||||| || |||||| |||||||| |||||||||||||||| |
|
|
| T |
2697750 |
caggcttccaaatctcattacattgttccttaggaccttcgtaaccgctggagcaattgttttggggcttgaatatgcagcttctgttttctcatgtttt |
2697849 |
T |
|
| Q |
125 |
ttggaaaggtaactcttgtgctgacaagctagcagccttggggcatgactgttttgatttttcttggtggcatactatttctgtcaaccttttggg |
220 |
Q |
| |
|
|| ||||||||||||||||||| | ||||||||||| ||||||||||||| |||| ||||||||||| |||||||| ||||| | ||||||| |
|
|
| T |
2697850 |
cagggaaggtaactcttgtgctgatacactagcagccttagggcatgactgttctgatatttcttggtgggatactattcatgtcagctttttggg |
2697945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 42 - 95
Target Start/End: Original strand, 16022147 - 16022200
Alignment:
| Q |
42 |
cattacattgttccttgggaccttcgtaaccgctggagtaattgtttcggtttg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
16022147 |
cattacattgttccttgggaccttcgtaatcgttggagtaattgtttcggtttg |
16022200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 260
Target Start/End: Original strand, 16022258 - 16022349
Alignment:
| Q |
169 |
atgactgttttgatttttcttggtggcatactatttctgtcaaccttttgggggacttgttttaggatcgttgcgatctcccgattttttgc |
260 |
Q |
| |
|
||||||||| |||||| |||||||| ||||| || || ||| ||||||| ||||||||||| ||||||||| |||||| || ||||||| |
|
|
| T |
16022258 |
atgactgttctgatttgacttggtgggatactgttcctctcagccttttgtgggacttgtttagggatcgttgtaatctcctgaatttttgc |
16022349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 186
Target Start/End: Complemental strand, 49733168 - 49733132
Alignment:
| Q |
150 |
aagctagcagccttggggcatgactgttttgattttt |
186 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
49733168 |
aagctagcagccttggggcatgacggttctgattttt |
49733132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University