View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19511_low_24 (Length: 208)
Name: NF19511_low_24
Description: NF19511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19511_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 60 - 192
Target Start/End: Complemental strand, 494658 - 494526
Alignment:
| Q |
60 |
tacattcttccataagaaatgaagcatggattatgatatgtaatactaatattttttcagtccacttgtttttgatgatatggtatcatgaacagctgag |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
494658 |
tacattcttccataagaaatgaagcatggattatgatatgtaattctaatattttttcagtccacttgtttttgatgatatggtatcatgaacagctgag |
494559 |
T |
|
| Q |
160 |
ttggataaaaataaatttgtcattaatcaatac |
192 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
494558 |
ttggataaaaacaaatttgtcattaatcaatac |
494526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University