View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19512_high_5 (Length: 305)
Name: NF19512_high_5
Description: NF19512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19512_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 32 - 281
Target Start/End: Original strand, 6169654 - 6169901
Alignment:
| Q |
32 |
cgtagttgattgtttttataaatagagagttcaagccctatagaataaaattggagatgcatgcgtaagaaaacaaaagtttgtattnnnnnnnnnnnng |
131 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
6169654 |
cgtatttgattgtttttataaatagagagttcaagccctatagaataaaattggagatgcatgcgtaagaatacaaaagtttgtattaaaaaaaaat--g |
6169751 |
T |
 |
| Q |
132 |
gaatttgttttttgaggataaacatagaaaacattacaaaatttggaaggtttattggaacaatgggatgaagttgctgctgctattattatttacaaac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169752 |
gaatttgttttttgaggataaacatagaaaacattacaaaatttggaaggtttattggaacaatgggatgaagttgctgctgctattattatttacaaac |
6169851 |
T |
 |
| Q |
232 |
ataggattttctgcaatgtcaatagcctcatttgtcccgttggtgttttc |
281 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6169852 |
ataggattttctgcaatgtcaatagcttcatttgtcccgttggtgttttc |
6169901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 6168615 - 6168649
Alignment:
| Q |
1 |
aattgtttttccgacctaaaccgtttgtgatcgta |
35 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
6168615 |
aattgtttttccgacctaaaccgtttgtaatcgta |
6168649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University