View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19512_low_10 (Length: 227)
Name: NF19512_low_10
Description: NF19512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19512_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 15 - 214
Target Start/End: Complemental strand, 32666719 - 32666524
Alignment:
| Q |
15 |
agtttcttacccctctctacttcatatttaactcatatcaagtttggttgggtaaccttcaagcaaaattcatttaaaatgaaaaa-tgttaactagtgc |
113 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
32666719 |
agtttcttgcccctctctacttcatatttaactcatatc-----tggttgggtaaccttcaagcaaaattcatttaaaattaaaaaatgttaagtagtgc |
32666625 |
T |
 |
| Q |
114 |
tctggagggattagttaagaaaacggacactaattaggaagactctttaaaattatatctccaatcaaacttcaatggtattattgtgtttttattttta |
213 |
Q |
| |
|
|| ||||||| |||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32666624 |
tccggagggactagttaaggaaacagacactaattaagaagactctttaaaattatatctccaatcaaacttcaacggtattattgtgtttttattttta |
32666525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University