View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19512_low_11 (Length: 214)

Name: NF19512_low_11
Description: NF19512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19512_low_11
NF19512_low_11
[»] chr8 (1 HSPs)
chr8 (14-65)||(27303821-27303872)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 14 - 65
Target Start/End: Original strand, 27303821 - 27303872
Alignment:
14 ttatactataataattccacaaattatattatacatgtcaatcaatacaaac 65  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
27303821 ttatactataataattccacaaattatattatacatgtcaatcaatacaaac 27303872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University