View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19513_low_8 (Length: 351)
Name: NF19513_low_8
Description: NF19513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19513_low_8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 145 - 351
Target Start/End: Original strand, 33688743 - 33688942
Alignment:
| Q |
145 |
gattaaaacatcgtatatattgcaggcatctctgcttttgttgctgcatctactacatgttttcgcatcttattaatctaacaaggatcataacataatt |
244 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33688743 |
gattaaaacatcgtatatactgcaggcatctctgcttttgttgctgcatctactacatgttttcgcatcttattaatctaacaaggatcataacataatt |
33688842 |
T |
 |
| Q |
245 |
tctaagcataaatattatgaacnnnnnnnnnnnnntcaaagctaaagagatatataaagcataactagtgcatgggatgttcaagaaaaatatcaatatt |
344 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33688843 |
tctaagcataaatattatgaac---ccaaaaaaaatcaaagctaaagag----ataaagcataactagtgcatgggatgttcaagaaaaatatcaatatt |
33688935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University