View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19514_high_22 (Length: 271)
Name: NF19514_high_22
Description: NF19514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19514_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 34024309 - 34024562
Alignment:
| Q |
1 |
ttgaagtcaatttttagtgcaacatcaccagttttttcttttgtcttgttcttcatagaatttataaattcagaagcagctaaagcattatcaagtatgg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34024309 |
ttgaagtcaatttttagtgcaatatcactagtttttccttttgtcttgctcttcatagaatttataaattcagaagcagctaaagcattatcaagtatgg |
34024408 |
T |
|
| Q |
101 |
acctg-acttcaacacaaattgattgattaatacttggacataattctcttcaatcaaatgtccatcactttatcaagaattttgtatacagcattacag |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34024409 |
acctggacttcaacacaaattgattgattaatacttggacataattctcttcaatcaaatgtccatcactttatcaagaattttgtatacagcattacag |
34024508 |
T |
|
| Q |
200 |
agtggtagatgtctccaatctttgatcgtgctttgaatctctcccaattggtaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34024509 |
agtggtagatgtctccaatctttgatcgtgctttgaatctctcccaattggtaa |
34024562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University