View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19514_high_31 (Length: 240)
Name: NF19514_high_31
Description: NF19514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19514_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 54864504 - 54864298
Alignment:
| Q |
15 |
aatattcccttggaaaatatcccaaattaaagtcttgattttgaaaagacccttctaatcaaagaaattcaagtagttttgatcaagaaataaccaccaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54864504 |
aatattcccttggaaaatatcccaaattaaagtcttgattatgaaaagacccttctaatcaaagaatttcaagtagttttgatcaagaaataaccaccaa |
54864405 |
T |
|
| Q |
115 |
aatagttaagcaagttgggataattaaccacattaagtttttcagtacacaaaatcttctatgtatgttctgtac---ttctgttctactacttgagtgg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54864404 |
aatagttaagcaagttgggataattaaccacattaagtttttcagtacacaaaa---tctatgtatgttctgtactaattctgttctactacttgagtgg |
54864308 |
T |
|
| Q |
212 |
ccggccactg |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
54864307 |
ccggccactg |
54864298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University