View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19514_high_34 (Length: 229)
Name: NF19514_high_34
Description: NF19514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19514_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 137 - 208
Target Start/End: Complemental strand, 39945828 - 39945757
Alignment:
| Q |
137 |
gcatgcaatatatactctaaagcgttaaaaacttttagaatatatactactgtatattctaccaatttatga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39945828 |
gcatgcaatatatactctaaagcgttaaaagcttctagaatatatactactgtatattctaccaatttatga |
39945757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 39946749 - 39946697
Alignment:
| Q |
19 |
agtatcatttgtactcatatctatcatatataaaattattcaacttttccgtt |
71 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39946749 |
agtatcatttgtactcatatctatcatctataaaattattcaacttttccgtt |
39946697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 137 - 185
Target Start/End: Complemental strand, 1494509 - 1494461
Alignment:
| Q |
137 |
gcatgcaatatatactctaaagcgttaaaaacttttagaatatatacta |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1494509 |
gcatgcaatatatactctaaagcgttaaaaacttttagaatatatacta |
1494461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 23096919 - 23096967
Alignment:
| Q |
137 |
gcatgcaatatatactctaaagcgttaaaaacttttagaatatatacta |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23096919 |
gcatgcaatatatactctaaagcgttaaaaacttttagaatatatacta |
23096967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 23096795 - 23096847
Alignment:
| Q |
19 |
agtatcatttgtactcatatctatcatatataaaattattcaacttttccgtt |
71 |
Q |
| |
|
||||||||||||||||| ||||||||| || |||||||||||||||||||||| |
|
|
| T |
23096795 |
agtatcatttgtactcacatctatcatctacaaaattattcaacttttccgtt |
23096847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 1494627 - 1494578
Alignment:
| Q |
19 |
agtatcatttgtactcatatctatcatatataaaattattcaacttttcc |
68 |
Q |
| |
|
||||||||||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
1494627 |
agtatcatttgtactcatatctatcgtctacaaaattattcaacttttcc |
1494578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University