View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19514_high_8 (Length: 428)
Name: NF19514_high_8
Description: NF19514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19514_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 1e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 306 - 412
Target Start/End: Original strand, 20855983 - 20856089
Alignment:
| Q |
306 |
aatttccaaggtttctctacactttagtcatcagttagtccttcattatgtattttttggtgagtctgatcatgaattcagtatcacaggactccaataa |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20855983 |
aatttccaaggtttctctacactttagtcatcagttagtccttcattatgtatttcttggtgagtctgatcatgaattcagtatcacaagactccaataa |
20856082 |
T |
 |
| Q |
406 |
atgttgt |
412 |
Q |
| |
|
||||||| |
|
|
| T |
20856083 |
atgttgt |
20856089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 163 - 198
Target Start/End: Complemental strand, 36108204 - 36108169
Alignment:
| Q |
163 |
ttaggccattactttcttaaaacattttcaattttc |
198 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36108204 |
ttaggccattactttcttgaaacattttcaattttc |
36108169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University